tceic.com
学霸学习网 这下你爽了
相关标签
当前位置:首页 >> 电子/电路 >>

5Amino acid differences in interferon-tau (IFN-τ) of Bos taurus Coreanae and Holstein


Cytokine 59 (2012) 273–279

Contents lists available at SciVerse ScienceDirect

Cytokine
journal homepage: www.elsevier.com/locate/issn/10434666

Amino acid differences in interferon-tau (IFN-s) of Bos taurus Coreanae and Holstein
Dongjun Kang b,1, Soyoon Ryoo a,1, Byunghyun Chung b, Joongbok Lee b, Seungyoung Park b, Jinsoo Han b, Sangmin Jeong b, Gyujin Rho c, Jaewoo Hong a, Suyoung Bae a, Taebong Kang a, Soseob Kim a, Soohyun Kim a,?
a b c

Laboratory of Cytokine Immunology, Department of Biomedical Science and Technology, Konkuk University, 120 Neungdong-ro, Gwangjin-gu, Seoul 143-701, Republic of Korea College of Veterinary Medicine, Konkuk University, 120 Neungdong-ro, Gwangjin-gu, Seoul 143-701, Republic of Korea College of Veterinary Medicine, Gyeongsang National University, 900 Gazwa, Jinju, GN 660-701, Republic of Korea

a r t i c l e

i n f o

a b s t r a c t
Interferons (IFNs) are commonly grouped into type I and type II IFN. Type I IFNs are known as antiviral IFNs including IFN-a, IFN-b, and IFN-x whereas type II IFN is referred to immune IFN and IFN-c is only member of the type II IFN. Type I IFNs are induced by virus invading however type II IFN is produced by mitogenic or antigenic stimuli. IFN-s was ?rst identi?ed in ruminant ungulates as a pregnancy recognition hormone, trophoblastin. IFN-s constitutes a new class of type I IFN, which possesses the common features of type I IFN, such as the ability to prevent viral infection and to limit cell proliferation. In addition, IFN-s is unique in that it is induced by pregnancy unlike other type I IFNs. We cloned Bos taurus (B. T.) Coreanae IFN-s from peripheral blood mononuclear cells. The amino acid sequence of B. T. Coreanae IFN-s shares only 90.3% identity with that of Holstein dairy cow. Recombinant B. T. Coreanae and Holstein IFN-s proteins were expressed in Escherichia coli and the antiviral activity of IFN-s proteins were examined. Both recombinant proteins were active and protected human WISH and bovine MDBK cells from the cytopathic effect of vesicular stomatitis virus. The recombinant IFN-s protein of B. T. Coreanae and Holstein properly induced the expression of antiviral genes including 20 ,50 -oligoadenylate synthetase (OAS) and Mx GTPase 1 (Mx-1). ? 2012 Published by Elsevier Ltd.

Article history: Received 19 April 2011 Received in revised form 14 September 2011 Accepted 29 March 2012 Available online 10 May 2012 Keywords: IFN-s Mx GTPase 1 (Mx-1) 20 ,50 -Oligoadenylate synthetase (OAS) Bos taurus Coreanae Trophoblastin

1. Introduction The different interferon (IFN) subtypes exist in vertebrates, which possess antiviral activities and immune responses varying with viruses, cells, and species. In mammals, the type I IFNs constitute a large multi gene family that mainly include IFN-a, -b and -x and bind to a common cell surface receptor, the type I IFN receptor (IFNaR1 and 2) [1–3]. IFN-s was recently classi?ed as a type I IFN present only in ruminants. Among type I IFNs, IFN-s amino acid sequence exhibits the greatest identity with IFN-x (70–75%), but is also quite similar to IFN-a and IFN-b. IFN-s amino acid sequence shares approximately 50% and 25% identity with IFN-a and IFN-b, respectively [4]. IFN-s binds to the common type I IFN receptors, a hetero dimeric form of IFNaR1 [5] and IFNaR2 [6]. The intracellular domain of the receptor binds tyrosine kinases (Janus kinases, JAKs), which are activated after IFN-s binding and subsequently phosphorylate downstream signaling molecules named signal transducers and activators of transcription (STATs). The dimerized STATs bind
? Corresponding author. Tel.: +82 2 450 4086; fax: +82 2 2030 7788.
1

E-mail address: soohyun.kim@konkuk.ac.kr (S. Kim). These two authors contributed equally to this work.

IRF9 to form a trimeric interferon-stimulated gene factor (ISGF3) complex, which is translocated to the nucleus where it binds an interferon-stimulated regulatory element (ISRE), resulting in the expression of the interferon regulatory factor-1 (IRF-1) gene [7]. The product of this gene activates the expression of IRF-2, which interacts with other regulatory elements to control the expression of IFN-s-responsive genes, including the oxytocin receptor (OTR) and estrogen receptor (ER). At present, it is uncertain whether IRF-2 controls the oxytocin receptor expression directly, via the estrogen receptor, or both [8,9]. IFN-s is produced mainly from trophoblasts of ruminant conceptuses during the blastocyst stage, when the elongated trophoblast attaches to the uterine wall. The secretion of IFN-s prevents the destruction of the corpus luteum and helps in maternal recognition of pregnancy. In ruminant reproduction, IFN-s constitutes an actual pregnancy signal [10–14]. In the pregnant period, IFNs produced by trophoblast are detected in other mammals but antiviral activity is almost non-detectable [15]. The viral defense mechanism triggered by type I IFNs is the blockade of viral gene transcription. The representative IFN-stimulated genes (ISGs) involved in antiviral activity are (i) double stranded RNA-dependent protein kinase (PKR), which inhibits translation initiation through the phosphorylation of protein

1043-4666/$ - see front matter ? 2012 Published by Elsevier Ltd. http://dx.doi.org/10.1016/j.cyto.2012.03.031

274

D. Kang et al. / Cytokine 59 (2012) 273–279 Table 1 The sense and reverse primers were used to perform RT-PCR, which were used to evaluate the induction of Mx-1 and OAS-1 transcripts by different IFNs. hMx-1 hOAS-1 bMx-1 bOAS-1 Sense Reverse Sense Reverse Sense Reverse Sense Reverse 50 -TGGGTCGGAGGCTACAG-30 50 -GGGCAACTCCTGACAGTGC-30 50 -CTTTGATGCCCTGGGTCAGT-30 50 -AGAATCCGGAGCTCACTGG-30 50 -AGAGCAACCTGTACAGCCAAT-30 50 -GGTAGCGATGTCCACGTTAG-30 50 -CGGCTCATCCAAGAGTGCAA-30 50 -CAGCAACATTTCCTGTAGGGT-30

synthesis initiation factor eIF-2a, (ii) the 20 ,50 -oligoadenylate synthetase (OAS) family and RNase L nuclease, which mediate RNA degradation, and (iii) the family of Mx protein GTPases (Mx), which appear to target viral nucleocapsids and inhibit RNA synthesis [16–19]. It has been reported that in the ovine endometrium in vivo or endometrial cells in vitro, ovine IFN-s induces or increases the expression of STAT-1 and -2, b-microglobulin, IRF-1, ubiquitin cross-reactive protein (UCRP; also known as IFN-stimulated gene 17), Mx-1 and 20 ,50 -oligoadenylate synthetase (OAS) [20] . Therefore bovine IFN-s would also evoke such ISG expression leading to the protection of hosts against viruses. IFN-s actually displayed antiviral activity in vitro against human immunode?ciency virus (HIV), feline immunode?ciency virus (FIV) and ovine lentivirus (OvLV) [21,22]. IFN-s induces the comparable antiviral activity to IFN-a and -b but does not cause cytotoxicity [17]. This is important because type I IFNs are potent therapeutic agents for the treatment of various diseases to prevent the infection of macrophages and the production of viral particles in these cells; however, they have a narrow therapeutic index [17–19]. Thus, the previous studies suggest that IFN-s is a possible candidate for antiviral drugs without toxic side effects. In this study, we cloned IFN-s genes of Holstein and Bos taurus (B. T.) Coreanae, main strains of cattle in Korea, and compared their antiviral activities in vitro using recombinant IFN-s proteins. 2. Materials and methods 2.1. Cells and reagents Human amnion (?broblast) WISH cells, Madin–Darby bovine kidney epithelial (MDBK) cells, and vesicular stomatitis virus (VSV; Indiana strain) were obtained from the American Type Culture Collection (ATCC, Manassas, VA) and the WISH and MDBK cells were cultured in a medium containing 1% penicillin–streptomycin (Life Technologies, Grand Island, NY), and 10% fetal bovine serum (Hyclone, Logan, UT) according to the ATCC’s instructions. Human recombinant IFNa2 protein was obtained from LG biotech (Seoul, Korea). The IgG–HRP conjugated secondary antibodies and anti–actin primary antibody were obtained from Santa Cruz Biotechnology (Santa Cruz, CA). 2.2. RNA extraction and RT-PCR for cloning Total RNA was isolated from whole blood of B. T. Coreanae and Holstein with the QIAamp RNA Blood Mini Kit (Qiagen, Valencia, CA). Five microliter of RNA was reverse-transcribed with 0.2 ll of Superscript II reverse transcriptase (Invitrogen, Carlsbad, CA) in 20 ll reaction volume. Two microliter of cDNA was propagated to perform PCR of bovine IFN-s with sense primer: 50 -GCAGCC ACATCTTCCCCATG-30 ; reverse primer: 50 -ATGTGGCATCTTAGTCA GCGA-30 . PCR mixture was denatured at 94 °C for 20 s, annealed at 59 °C for 40 s, elongated at 72 °C for 1 min, and reacted 30 cycles. The PCR products were resolved by 1%-agarose gel electrophoresis. The PCR product was visualized under UV trans-illuminator. 2.3. Construction of IFN-s expression vector The RT-PCR product of IFN-s was ligated into T&A cloning vector (RBC Bioscience, Xindian City, Taiwan) and the cDNA insert was veri?ed with DNA sequencing analysis (COSMO Genetech, Seoul, Korea). The region of mature IFN-s, which is removed signal peptides, was ampli?ed by PCR method with primers containing EcoRI recognition site at 50 end and XbaI recognition site at 30 end (sense

primer: 50 - TCCCGAATTCCGATCTCTGGGTTGTTAC -30 ; reverse primer: 50 - ATTTTCTAGA TCAAAGTGAGTTCAGATC -30 ). The PCR product was trimmed with EcoRI and XbaI, and ligated into pProEx/HTa expression vector (Invitrogen). The open reading frame (ORF) of IFN-s pProEx/HTa vector was transformed into Escherichia coli (DH5a). The sequence of the cloned insert of IFN-s cDNA was veri?ed by DNA sequencing prior to expressing recombinant IFN-s protein. 2.4. Expression and puri?cation of recombinant proteins DNA sequencing-con?rmed IFN-s pProEx/HTa vector was transferred into BL21/codon plus or BL21/Rosetta (Promega, Fitchburg, WI) because the yield of recombinant IFN-s in DH5a was not high enough (data not shown). Each BL21/codon plus or BL21/Rosetta was cultured in 1 ml volume of Luria–Bertani (LB) broth. The pilot experiment examined the level of recombinant protein in insoluble pellet or soluble supernatant by western blotting. B. T. Coreanae and Holstein IFN-s were expressed in BL21/Rosetta since this strain yielded the highest proteins. The cells were cultured at 37 °C. When the O.D. of cultured broth at 600 nm reached 0.6 O.D., IPTG was added to induce the target protein expression for 3 h at 37 °C. After 3 h, the cells were collected by centrifugation at 8000 rpm for 15 min at 4 °C, resuspended in basic buffer (8 M UREA, 20 mM Tris–HCl, pH 8.0), and subjected to ultrasonication. After overnight incubation at 37 °C, the supernatant was collected by centrifugation at 10,000 rpm for 20 min at 4 °C and followed by sonication (pulse 30 s and interval 30 s for 2 min). It was then centrifuged at 10 000 rpm for 10 min at 20 °C, when the supernatant was collected for puri?cation. The recombinant IFN-s protein was puri?ed with a TALON af?nity column (Invitrogen) using his6-tag at N-terminus of the recombinant protein. Before loading the collected supernatant, the basic buffer was loaded onto TALON column for washing and equilibrium. The supernatant was loaded onto the column twice, and 0.1% Triton X 114 in basic buffer was loaded to remove lipopolysaccharide (LPS) [23]. After washing with basic buffer, the protein was eluted with elution buffer (8 M UREA,

Fig. 1. The expression and induction of bovine IFN-s transcripts. (A) RT-PCR was performed from the whole blood RNA of Korean domestic cow (B. T. Coreanae) and Holstein dairy cow. (B) The RT-PCR of IFN-c and IFN-s was performed in Holstein originated MDBK cells under stimulation of poly (I:C) at time point of 3, 6 and 18 h. The data represents one of three independent experiments.

D. Kang et al. / Cytokine 59 (2012) 273–279

275

20 mM Tris–HCl, pH 8.0, 150 mM imidazole). Four fractions (1 ml per fraction) were collected. After SDS–PAGE (polyacrylamide gel electrophoresis), the protein bands were visualized by staining with Coomassie brilliant blue (CBB) and analyzed by western blot using mouse monoclonal antibody against his6-tag (R&D system, Minneapolis, MN). The TALON af?nity-puri?ed protein was dialyzed in 20 mM Tris–HCl (pH 8.0) overnight at 4 °C, and digested by TEV protease (Invitrogen) for 3 h at 30 °C to remove the his6-tag. The tag-removed recombinant protein was subjected to high performance liquid chromatography (HPLC), and then lyophilized. The lyophilized

protein was suspended in 20 mM Tris–HCl (pH 8.0), and stained with silver nitrate to con?rm the protein purity. The HPLC puri?ed recombinant IFN-s protein was used for antiviral assay. 2.5. Cytopathic effect of antiviral assay To determine the antiviral activity of recombinant bovine IFN-s, vesicular stomatitis virus (VSV) inhibition assay was performed with bovine MDBK and human WISH cells. These cells were cultured in 96-well plates until the cells reached monolayer status. Then the cells were washed and bovine IFN-s proteins were added

Fig. 2. The amino acid sequence of B. T. Coreanae IFN-s shows 90.3% identity to that of Holstein dairy cow. (A) The ORF of IFN-s mRNA from B. T. Coreanae was analyzed by DNA sequencing and newly identi?ed B. T. Coreanae was deposited in gen bank (accession number: HQ235019). (B) The amino acid sequence was deduced by newly obtained the DNA sequence of B. T. Coreanae and Holstein. The different amino acid residue of B. T. Coreanae compared to Holstein is marked as bolded letter.

276

D. Kang et al. / Cytokine 59 (2012) 273–279

(Sigma–Aldrich, St. Louis, MO) for 15 min at 60 The DNA probe C. was synthesized with Klenow fragment (Takara Shuzo Co., Kyoto, Japan) and a-dCTP-P32 with human Mx-1 DNA template for 3 h at 37 The probe was puri?ed with Sepharose G25 spin column C. (Roche, Basel, Switzerland). The puri?ed probe was hybridized on the RNA blot overnight at 60 The hybridized blot was washed C. with 2? SSC (saline-sodium citrate) containing 0.1% SDS at 65 C for 5 min. The blot was additionally washed twice with 0.5? SSC containing 0.1% SDS for 20 min and once with 0.1? SSC containing 0.1% SDS at 65 for 20 min. The washed blot was visualized and C analyzed with FLA-7000 imaging device (Fuji?lm, Tokyo, Japan).

3. Results 3.1. Cloning of IFN-s from bovine peripheral whole blood cells and its regulation in MDBK cells In order to obtain IFN-s cDNA, we performed RT-PCR with total RNA from the whole blood cells of B. T. Coreanae and Holstein dairy cow. The predicted size of PCR product was observed in normal whole blood cells from B. T. Coreanae and Holstein dairy cow, respectively (Fig. 1A). These PCR products were inserted into T&A cloning vector and veri?ed by DNA sequencing. The region of mature protein without signal sequence was subcloned into pProEx/ HTa vector for E. coli expression. The regulation of IFN-s was examined with MDBK cells under the stimulation of poly (I:C), a mimic of double strand viral RNA, at different time points. Unlike bovine IFN-c, the transcript of IFN-s was expressed spontaneously in the absence of stimulation (Fig. 1B), which was consistent with the results from whole blood cell (Fig. 1A). IFN-s transcript was induced by poly (I:C) at 3 h and decreased gradually (Fig. 1B in middle panel) despite of the constitutive expression. However IFN-c transcript appeared only at 3 h of poly (I:C) stimulation and disappeared during longer stimulation (in top panel of Fig. 1B). 3.2. The amino acid sequence of B.T. Coreanae IFN-s is distinct from Holstein The DNA sequencing analysis revealed that the cDNA sequence of Holstein IFN-s completely corresponded to bovine IFN-s sequence in genebank. The deduced amino acid sequence of IFN-s from B. T. Coreanae is exhibited in Fig. 2A. Interestingly the cloned cDNA sequence of B. T. Coreanae IFN-s was different from Holstein, and B. T. Coreanae IFN-s has two less amino acids (Ser and Pro) at the end of C-terminus due to an early stop codon (Fig. 2B). The amino sequence of B. T. Coreanae IFN-s shares 90.3% identity with that of Holstein dairy cow and the distinct amino acid residue is indicated by a bolded letter (Fig. 2B). Newly identi?ed B. T. Coreanae was deposited in gene bank (accession number: HQ235019). 3.3. Recombinant Bovine IFN-s proteins were expressed in large scale and processed by a multistep puri?cation In order to compare the expression ef?ciency of target protein in E. coli, the expression vectors were transformed into several E. coli strains including DH5a, BL-21/Codon plus and BL-21/Rosetta, respectively. The production of recombinant proteins was induced by adding IPTG and the result was con?rmed by western blot analysis by using anti-his6-tag antibody (data not shown). Rosetta strain yielded the highest production of B. T. Coreanae recombinant proteins whereas the yield of Holstein recombinant IFN-s protein was similar in both Codon plus and Rosetta strain (data not shown). Therefore a large scale expression was processed with

Fig. 3. The expression and puri?cation of recombinant bovine IFN-s with TALON metal af?nity chromatography. The recombinant bovine IFN-s from B. T. Coreanae (A and C) or Holstein (B and D) was expressed in E. coli and puri?ed by TALON metal af?nity column. The puri?ed protein was visualized by CBB staining (A and B) and analyzed by using western blotting with mouse anti-his6-tag monoclonal antibody (C and D). Lanes 1–3; the eluted fractions from TALON metal af?nity column, Lane 4; E. coli pellet after lysis, Lane 5; Supernatant of E. coli lysate before loading onto TALON metal af?nity column, Lane 6; Unbound sample after puri?cation with TALON metal af?nity column. The data represents one of ?ve independent experiments.

to the plate. Human IFN-a2 was used as a positive control. IFN-s proteins and IFN-a2 were used to treat the cell by a 3-fold serial dilution. The treated cells were incubated with IFNs for 12 h and then VSV was added for infection. After 40 h of VSV infection, the media was removed and the cells were stained with crystal violet solution.

2.6. RT-PCR and Northern Blot analysis WISH or MDBK cells (1 ? 106 cells/well in 6-well plates, TPP, Trasadingen, Switzerland) were treated with human IFN-a2 (5 ng/ml) and IFN-s (250 ng/ml) at different time points (1, 3 or 9 h) and then harvested for RNA extraction. Total RNA was isolated with Tri reagent (Sigma–Aldrich, St. Louis, MO) according to manufactures manual. Two microgram of RNA samples were prepared for RT-PCR. Primer sequences for Mx-1 and OAS-1 are shown in Table 1. For the Northern blot, 10 lg RNA was loaded on 1% formaldehyde-agarose gel. 28s and 18s of ribosomal (rRNA) were used to normalize RNA samples. The gel was transferred to a charged nylon membrane (PALL, Port Washington, NY) overnight by weight based capillary system. The RNA and the membrane were cross-linked at 80 for 2 h. The blot was prehybridized with PerfectHyb C

D. Kang et al. / Cytokine 59 (2012) 273–279

277

Fig. 4. The puri?cation of bovine IFN-s by using C4 column. UV absorbance at 280 nm was recorded during the running process (A and C). The puri?ed fractions were visualized by silver staining (B and D). The data represents one of four independent experiments.

Rosetta strain and the production of recombinant IFN-s proteins was present in an insoluble fraction (Fig. 3). The ?rst step of puri?cation was performed by using a mini-TALON af?nity column. The eluted fractions from the TALON af?nity column were analyzed by Coomassie stain and western blot. The molecular weight of B. T. Coreanae IFN-s (Fig. 3A) and Holstein IFN-s (Fig. 3B) appeared to be approximately 24 kDa band in Coomassie stain (see the arrow). In western blot, 24 and 48 kDa bands were detected by anti-his6-tag antibody and the 48 kDa band is probably a dimmer form of recombinant IFN-s (Fig. 3C and D). The puri?ed recombinant IFN-s proteins by TALON af?nity column were cleaved with TEV protease and then puri?ed by HPLC by using C4 column. The elution peak of IFN-s was observed between the fraction 54 and 60 in both recombinant IFN-s (Fig. 4A and C). The HPLC fractions were visualized by silver staining to con?rm the purity of the his6-tag fusion part removed recombinant IFN-s proteins. The puri?ed recombinant IFN-s appeared to be approximately 20 kDa in silver staining (Fig. 4 B and D).

IFN-s proteins-dissolved in PBS was weaker than in Tris buffer (Fig. 5A and C). Bovine recombinant IFN-c protein was prepared for antiviral assay and the process of expression and puri?cation was similar to recombinant IFN-s (data not shown). However, bovine recombinant IFN-c from both strains possessed weak antiviral activity on WISH cell and on MDBK cells (Fig. 5). 3.5. The antiviral activity of B. T. Coreanae IFN-s through Mx-1 and OAS-1 To investigate the antiviral mechanism of IFN-s, the induction of IFN-stimulated genes was examined by RT-PCR. The levels of Mx-1 and 20 ,50 -OAS were increased in both WISH and MDBK cells treated with IFN-s at 3 and 9 h (Fig. 6A) however the induction of antiviral genes was more prominent in MDBK cells (Fig. 6B). We also examined other antiviral genes such as IRF3 and IRF7, however there was no difference between IFN-s treated and nontreated cells (data not shown). To verify the RT-PCR data we further performed northern blot after stimulation of IFN-s at different time points and Mx-1 appeared similar to the result of RT-PCR (Fig. 6C). We also examined 2-5A OSA with Northern blot but we did obtain a speci?c band probably due to an inappropriate cDNA probe (data not shown). 4. Discussion In the present study, we cloned IFN-s genes of Holstein dairy cow and B. T. Coreanae, main strain of cattle in Korea, and

3.4. Coreanae IFN-s had antiviral activity against VSV in vitro The antiviral assay was performed with WISH and MDBK cells to evaluate their antiviral activity varying on cell types. The antiviral activity of B. T. Coreanae and Holstein IFN-s proteins was exhibited in WISH (Fig. 5B) and MDBK cells (Fig. 5D). In the case of his6tag fused IFN-s, the antiviral activity was weak (data not shown). Therefore we removed the N-terminal his6-tag from recombinant IFN-s prior to purifying HPLC (Fig. 4). The antiviral activity of

278

D. Kang et al. / Cytokine 59 (2012) 273–279

Fig. 5. Recombinant bovine IFN-s reduces the cytopathic effect caused by VSV. Human epithelial WISH cells (A and B) and bovine MDBK cells (C and D) were treated with recombinant bovine IFN then infected with VSV to analyze the reduction of cytopathic effect. The plate was visualized with crystal violet staining. Each IFN was indicated at the top of ?gure. The concentration of human IFN-a2 (5 ng/ml) and bovine IFNs (250 ng/ml) were added by the three fold serial dilution. For control in the last column, upper four wells is non-infected cells; lower four wells only VSV infected cells which shows the complete cytopathic effect to VSV challenge. Bovine IFNs were dissolved in PBS (A and C) or 20 mM Tris–Cl, pH 8.0 (B and D). The data represents one of three independent experiments.

Fig. 6. Recombinant bovine IFN-s induces antiviral genes. WISH (A and C) or MDBK (B) cells were treated with human IFN-a2 (5 ng/ml, lane 2), B. T. Coreanae IFN-s (250 ng/ml, lane 3) or Holstein IFN-s (250 ng/ml, lane 4) at indicated time points (1, 3 and 9 h). Non-treated cells were prepared as negative control (lane 1). After treatment of IFN-s, total RNA was extracted for RT-PCR (A and B) and Northern blotting analysis (C).

expressed recombinant proteins in E. coli. We cloned B. T. Coreanae and Holstein IFN-s and interestingly, the amino acid sequence of B. T. Coreanae IFN-s is distinct from that of Holstein IFN-s in genebank (accession number: NM_001015511). The amino acid sequence of B. T. Coreanae IFN-s shares only 90.3 % identity with that of Holstein dairy cow. We deposited B. T. Coreanae IFN-s in gene bank and obtained its accession number (HQ235019). Both bovine recombinant IFN-s proteins were expressed in E. coli and the biological activities were examined. The antiviral activity of B. T. Coreanae IFN-s was weaker in its cytopathic effect of antiviral assay in vitro compared to Holstein IFN-s. The antiviral activity of Holstein IFN-s in MDBK cells was more potent than that of B. T. Coreanae IFN-s. However, there was no difference in WISH cells (Fig. 5). The difference of antiviral activity was more distinct in Holstein cow derived MDBK cells than in human derived WISH cells. Although IFN-a, -b, -x and -s bind to common type I receptors, their bindings and biological activities clearly exhibit species-, tissue- and cell- speci?c differences probably due to three dimensional conformation differences among Type I IFN ligands [4]. Thus, the result indicated that the low activity of B. T. Coreanae IFN-s in MDBK cells could be due to difference in amino acid sequence between B. T. Coreanae and Holstein IFN-s (Fig. 2). The biological activity of B. T. Coreanae IFN-s would be optimized in cells of their own strain bearing high-af?nity receptors. Type I IFNs induce the synthesis of antiviral factors involving 20 ,50 -OAS, PKR and Mx-1 genes via activation of the cellular

Jak-STAT signaling pathway [3,6]. The IFN-inducible 20 -50 oligoadenylate synthesis leading to the degradation of RNA requires two enzymes, OAS and RNase L [24]. Three isoforms of OAS, designated as OAS1, OAS2, and OAS3, have been identi?ed in human cells by immunoblotting and by characterization of cDNA and genomic clone analysis [25,26], however it is known that the oligomerization of OAS1 and OAS2 appears necessary for enzymatic activity [27–30]. RNase L, a latent endoribonuclease, becomes active by binding 2-5 A oligonucleotides and digests the unusual RNAs. We found that IFN-s increased the synthesis of the cellular antiviral factors, such as 20 ,50 -OAS and Mx-1 proteins (Fig. 6). These results suggest that IFN-s induces the antiviral activity through similar pathways as other type I IFNs. The PKR is capable of inhibiting transcription. It does so by preventing viral replication by phosphorylating the initiation factor eIF2, which inhibits viral replication directly [31,32]. The Mx-A and Mx-1 proteins of the Mx family are well characterized IFNinducible gene products possessing antiviral activity. The direct experimental evidence obtained from animal model studies that Mx alone is suf?cient to block the replication of virus in the absence of any other IFN-a/b-inducible proteins [31,32]. The spectrum of antiviral activities of the Mx proteins, and the molecular mechanisms of viral replication, are dependent on the speci?c Mx protein as well as its subcellular site of localization and type of virus. In Fig. 6, IFN-s induced Mx protein transcript in both RT-PCR and northern blot suggested that the antiviral activity of IFN-s is similar to that of the known type I IFNs (Fig. 6C). In the case of anti-proliferative effects, one of the causes for cytotoxicity, IFN-s affected Daudi cells (a human Burkitt lymphoma cell line) less than IFN-a [33]. IFN-a would lead to cell cycle

D. Kang et al. / Cytokine 59 (2012) 273–279

279

blockade at G1 phase, probably through the inhibition of the cyclin-dependent kinase, cdk2. The differential cytotoxicity could be due to different af?nities of IFN-a and -s for the type I receptor resulting in the activation of a distinct signal pathway. In MDBK cells, IFN-a has a higher af?nity than IFN-s for the receptor [34]. As shown in Fig. 5, human IFN-a exhibited the highest antiviral activity with very low concentration. The anti-proliferating effect is manifested only at higher receptor occupancy [33], and thus higher concentrations of IFN-s would be required than of IFN-a for toxicity. IFN-s showed fewer side effects than IFN-b in trophoblast [35]. IFN-b is therapeutically effective in experimental murine allergic encephalomyelitis and multiple sclerosis, and has potent antiviral activity against the human and feline immunode?ciency retroviruses and against ovine lentivirus and human papilloma virus [36,37]. However, it does have acute side effects after systemic administration on T-cell populations, and can cause symptoms of acute cytokine poisoning in some species [35]. Therefore IFN-s may substitute IFN-a and -b as more safe drug in ruminant animals. This study describes cloning and characterization of interferon tau from B. T. Coreanae, the main strain of cattle in Korea. Unexpectedly, the amino acid sequence of this IFN-s differs by about 10% from that of the Western Holstein strain. Comparing the Coreanae and Holstein variants (Fig. 2B) reveals very signi?cant differences in some amino acids of mature form: A74P, P107Q, T137M and Q192L. In addition, the Coreanae variant is shorter by two amino acid residues than the Holstein variant. Such differences could stem from the relative isolation of the Korean peninsula. Yet, the fact that both variants exhibit similar biological activity is quite interesting. In further study, it is necessary to con?rm that the biological activity of B. T. Coreanae IFN-s is related to the ef?ciency of pregnancy. We expect that the recombinant bovine IFN-s would prevent viral infection with lower cytotoxicity than other existing IFNs therapies and be used to develop drug for increment of bovine pregnancy. In addition, this expression system could enable to produce the large quantity of biologically active recombinant IFN-s and to develop further studies on bovine IFN-s. Acknowledgements This study was supported by a grant of the National Research Foundation funded by the Korean government (WCU: R33-2008000-10022-0, and KRF-2008-313-C00644) and the Korea Healthcare technology R&D Project, Ministry of Health & Welfare, Republic of Korea (A100460). References
[1] Mogensen KE, Lewerenz M, Reboul J, Lutfalla G, Uze G. The type I interferon receptor: structure, function, and evolution of a family business. J Interferon Cytokine Res 1999;19:1069–98. [2] Oritani K, Kincade PW, Zhang C, Tomiyama Y, Matsuzawa Y. Type I interferons and limitin: a comparison of structures, receptors, and functions. Cytokine Growth Factor Rev 2001;12:337–48. [3] Uze G, Schreiber G, Piehler J, Pellegrini S. The receptor of the type I interferon family. Curr Top Microbiol Immunol 2007;316:71–95. [4] Roberts RM, Liu L, Alexenko A. New and atypical families of type I interferons in mammals: comparative functions, structures, and evolutionary relationships. Prog Nucleic Acid Res Mol Biol 1997;56:287–325. [5] Uze G, Lutfalla G, Gresser I. Genetic transfer of a functional human interferon alpha receptor into mouse cells: cloning and expression of its cDNA. Cell 1990;60:225–34. [6] Novick D, Cohen B, Rubinstein M. The human interferon alpha/beta receptor: characterization and molecular cloning. Cell 1994;77:391–400. [7] Gray CA, Abbey CA, Beremand PD, Choi Y, Farmer JL, Adelson DL, et al. Identi?cation of endometrial genes regulated by early pregnancy, progesterone, and interferon tau in the ovine uterus. Biol Reprod 2006;74:383–94.

[8] Binelli M, Subramaniam P, Diaz T, Johnson GA, Hansen TR, Badinga L, et al. Bovine interferon-tau stimulates the Janus kinase-signal transducer and activator of transcription pathway in bovine endometrial epithelial cells. Biol Reprod 2001;64:654–65. [9] Roberts RM. Interferon-tau, a Type 1 interferon involved in maternal recognition of pregnancy. Cytokine Growth Factor Rev 2007;18:403–8. [10] Bazer FW, Spencer TE, Ott TL. Interferon tau: a novel pregnancy recognition signal. Am J Reprod Immunol 1997;37:412–20. [11] Chen Y, Green JA, Antoniou E, Ealy AD, Mathialagan N, Walker AM, et al. Effect of interferon-tau administration on endometrium of nonpregnant ewes: a comparison with pregnant ewes. Endocrinology 2006;147:2127–37. [12] Roberts RM, Cross JC, Leaman DW. Interferons as hormones of pregnancy. Endocr Rev 1992;13:432–52. [13] Spencer TE, Becker WC, George P, Mirando MA, Ogle TF, Bazer FW. Ovine interferon-tau regulates expression of endometrial receptors for estrogen and oxytocin but not progesterone. Biol Reprod 1995;53:732–45. [14] Wolfsdorf KE, Diaz T, Schmitt EJ, Thatcher MJ, Drost M, Thatcher WW. The dominant follicle exerts an interovarian inhibition on FSH-induced follicular development. Theriogenology 1997;48:435–47. [15] Robinson RS, Mann GE, Lamming GE, Wathes DC. The effect of pregnancy on the expression of uterine oxytocin, oestrogen and progesterone receptors during early pregnancy in the cow. J Endocrinol 1999;160:21–33. [16] Pontzer CH, Bazer FW, Johnson HM. Antiproliferative activity of a pregnancy recognition hormone, ovine trophoblast protein-1. Cancer Res 1991;51:5304–7. [17] Pontzer CH, Torres BA, Vallet JL, Bazer FW, Johnson HM. Antiviral activity of the pregnancy recognition hormone ovine trophoblast protein-1. Biochem Biophys Res Commun 1988;152:801–7. [18] Skopets B, Li J, Thatcher WW, Roberts RM, Hansen PJ. Inhibition of lymphocyte proliferation by bovine trophoblast protein-1 (type I trophoblast interferon) and bovine interferon-alpha I1. Vet Immunol Immunopathol 1992;34:81–96. [19] Soos JM, Subramaniam PS, Hobeika AC, Schiffenbauer J, Johnson HM. The IFN pregnancy recognition hormone IFN-tau blocks both development and superantigen reactivation of experimental allergic encephalomyelitis without associated toxicity. J Immunol 1995;155:2747–53. [20] Stewart MD, Johnson GA, Bazer FW, Spencer TE. Interferon-tau (IFNtau) regulation of IFN-stimulated gene expression in cell lines lacking speci?c IFNsignaling components. Endocrinology 2001;142:1786–94. [21] Juste RA, Ott TL, Kwang J, Bazer FW, de la Concha-Bermejillo A. Effects of recombinant interferon-tau on ovine lentivirus replication. J Interferon Cytokine Res 1996;16:989–94. [22] Rogez C, Martin M, Dereuddre-Bosquet N, Martal J, Dormont D, Clayette P. Anti-human immunode?ciency virus activity of tau interferon in human macrophages: involvement of cellular factors and beta-chemokines. J Virol Methods 2003;77:12914–20. [23] Aida Y, Pabst MJ. Removal of endotoxin from protein solutions by phase separation using Triton X-114. J Immunol Methods 1990;132:191–5. [24] Kerr IM, Brown RE. ppp A2’p5’A20 p50 A: an inhibitor of protein synthesis synthesized with an enzyme fraction from interferon-treated cells. Proc Natl Acad Sci U S A 1978;75:256–60. [25] Rebouillat D, Hovanessian AG. The human 20 ,50 -oligoadenylate synthetase family: interferon-induced proteins with unique enzymatic properties. J Interferon Cytokine Res 1999;19:295–308. [26] Rebouillat D, Hovnanian A, Marie I, Hovanessian AG. The 100-kDa 20 ,50 oligoadenylate synthetase catalyzing preferentially the synthesis of dimeric ppp A20 p50 A molecules is composed of three homologous domains. J Biol Chem 1999;274:1557–65. [27] Ghosh A, Desai SY, Sarkar SN, Ramaraj P, Ghosh SK, Bandyopadhyay S, et al. Effects of mutating speci?c residues present near the amino terminus of 20 -50 oligoadenylate synthetase. J Biol Chem 1997;272:15452–8. [28] Ghosh A, Sarkar SN, Guo W, Bandyopadhyay S, Sen GC. Enzymatic activity of 2’-5’-oligoadenylate synthetase is impaired by speci?c mutations that affect oligomerization of the protein. J Biol Chem 1997;272:33220–6. [29] Sarkar SN, Bandyopadhyay S, Ghosh A, Sen GC. Enzymatic characteristics of recombinant medium isozyme of 20 -50 oligoadenylate synthetase. J Biol Chem 1999;274:1848–55. [30] Sarkar SN, Ghosh A, Wang HW, Sung SS, Sen GC. The nature of the catalytic domain of 20 -50 -oligoadenylate synthetases. J Biol Chem 1999;274:25535–42. [31] Arnheiter H, Frese M, Kambadur R, Meier E, Haller O. Mx transgenic mice– animal models of health. Curr Top Microbiol Immunol 1996;206:119–47. [32] Haller O, Frese M, Kochs G. Mx proteins: mediators of innate resistance to RNA viruses. Rev Sci Tech 1998;17:220–30. [33] van der Bliek AM. Functional diversity in the dynamin family. Trends Cell Biol 1999;9:96–102. [34] Subramaniam PS, Khan SA, Pontzer CH, Johnson HM. Differential recognition of the type I interferon receptor by interferons tau and alpha is responsible for their disparate cytotoxicities. Proc Natl Acad Sci U S A 1995;92:12270–4. [35] Soos JM, Johnson HM. Interferon-tau: prospects for clinical use in autoimmune disorders. BioDrugs 1999;11:125–35. [36] Schaefer C, Hidalgo TR, Cashion L, Petry H, Brooks A, Szymanski P, et al. Genebased delivery of IFN-beta is ef?cacious in a murine model of experimental allergic encephalomyelitis. J Interferon Cytokine Res 2006;26:449–54. [37] Soos JM, Mujtaba MG, Subramaniam PS, Streit WJ, Johnson HM. Oral feeding of interferon tau can prevent the acute and chronic relapsing forms of experimental allergic encephalomyelitis. J Neuroimmunol 1997;75:43–50.


推荐相关:
网站首页 | 网站地图
All rights reserved Powered by 学霸学习网 www.tceic.com
copyright ©right 2010-2021。
文档资料库内容来自网络,如有侵犯请联系客服。zhit325@126.com